<!-- # COPYRIGHT NOTICE # This file is part of the "Universal Biomedical Skills" project. # Copyright (c) 2026 MD BABU MIA, PhD <md.babu.mia@mssm.edu> # All Rights Reserved. # # This code is proprietary and confidential. # Unauthorized copying of this file, via any medium is strictly prohibited. # # Provenance: Authenticated by MD BABU MIA -->

---

name: bio-primer-design-primer-basics description: Design PCR primers for a target sequence using primer3-py. Specify target regions, product size, melting temperature, and other constraints. Returns ranked primer pairs with quality metrics. Use when designing standard PCR primers. tool_type: python primary_tool: primer3-py measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:

• read_file
• run_shell_command

---

PCR Primer Design

Design PCR primers using primer3-py, the Python binding for Primer3.

Required Imports

import primer3
from primer3 import p3helpers
from Bio import SeqIO
from Bio.Seq import Seq

Sequence Preparation (p3helpers)

# Sanitize sequence (uppercase, remove whitespace)
raw_seq = '  atgc gatc GATC  '
clean_seq = p3helpers.sanitize_sequence(raw_seq)
print(f'Cleaned: {clean_seq}')  # 'ATGCGATCGATC'

# Reverse complement for designing reverse primers
seq = 'ATGCGATCGATC'
rc_seq = p3helpers.reverse_complement(seq)
print(f'Reverse complement: {rc_seq}')  # 'GATCGATCGCAT'

# Ensure valid DNA sequence (ACGT only, uppercase)
valid_seq = p3helpers.ensure_acgt_uppercase('atgcNNgatc')  # Raises error if invalid

Basic Primer Design

sequence = 'ATGCGTACGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG'

result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': sequence},
    global_args={
        'PRIMER_PRODUCT_SIZE_RANGE': [[100, 300]],
        'PRIMER_MIN_TM': 57.0,
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MAX_TM': 63.0,
        'PRIMER_MIN_GC': 40.0,
        'PRIMER_MAX_GC': 60.0,
    }
)

Extract Primer Results

num_returned = result['PRIMER_PAIR_NUM_RETURNED']
print(f'Found {num_returned} primer pairs')

for i in range(num_returned):
    left = result[f'PRIMER_LEFT_{i}_SEQUENCE']
    right = result[f'PRIMER_RIGHT_{i}_SEQUENCE']
    left_tm = result[f'PRIMER_LEFT_{i}_TM']
    right_tm = result[f'PRIMER_RIGHT_{i}_TM']
    product_size = result[f'PRIMER_PAIR_{i}_PRODUCT_SIZE']
    print(f'Pair {i}: {left} / {right}')
    print(f'  Tm: {left_tm:.1f}C / {right_tm:.1f}C, Product: {product_size}bp')

Target a Specific Region

# Target a specific region: [start, length]
result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_TARGET': [100, 50],  # Target region at position 100, length 50
    },
    global_args={
        'PRIMER_PRODUCT_SIZE_RANGE': [[150, 300]],
        'PRIMER_OPT_TM': 60.0,
    }
)

Primers Must Span a Region

# Primers must span this region (e.g., exon junction)
result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_INCLUDED_REGION': [50, 200],  # Primers within this region
    },
    global_args={'PRIMER_PRODUCT_SIZE_RANGE': [[100, 250]]}
)

Exclude Regions

# Exclude regions (e.g., SNP positions, repeats)
result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_EXCLUDED_REGION': [[150, 20], [300, 15]],  # Regions to avoid
    },
    global_args={'PRIMER_PRODUCT_SIZE_RANGE': [[100, 300]]}
)

Constrain Primer Positions

# Force primer to overlap a specific position
result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_FORCE_LEFT_START': 50,   # Left primer must start here
        'SEQUENCE_FORCE_RIGHT_START': 250,  # Right primer must start here
    },
    global_args={'PRIMER_PRODUCT_SIZE_RANGE': [[150, 250]]}
)

Design for Sequencing

# Single primer for sequencing
result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': sequence},
    global_args={
        'PRIMER_PICK_LEFT_PRIMER': 1,
        'PRIMER_PICK_RIGHT_PRIMER': 0,  # Only design left primer
        'PRIMER_PICK_INTERNAL_OLIGO': 0,
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_MAX_SIZE': 25,
    }
)

Full Parameter Control

result = primer3.design_primers(
    seq_args={
        'SEQUENCE_TEMPLATE': sequence,
        'SEQUENCE_TARGET': [200, 50],
    },
    global_args={
        'PRIMER_PRODUCT_SIZE_RANGE': [[150, 300], [300, 500]],  # Multiple ranges
        'PRIMER_NUM_RETURN': 5,
        'PRIMER_MIN_SIZE': 18,
        'PRIMER_OPT_SIZE': 20,
        'PRIMER_MAX_SIZE': 25,
        'PRIMER_MIN_TM': 57.0,
        'PRIMER_OPT_TM': 60.0,
        'PRIMER_MAX_TM': 63.0,
        'PRIMER_MIN_GC': 40.0,
        'PRIMER_OPT_GC_PERCENT': 50.0,
        'PRIMER_MAX_GC': 60.0,
        'PRIMER_MAX_POLY_X': 4,           # Max consecutive identical bases
        'PRIMER_MAX_NS_ACCEPTED': 0,       # No ambiguous bases
        'PRIMER_MAX_SELF_ANY': 8,          # Self-complementarity
        'PRIMER_MAX_SELF_END': 3,          # 3' self-complementarity
        'PRIMER_PAIR_MAX_COMPL_ANY': 8,    # Pair complementarity
        'PRIMER_PAIR_MAX_COMPL_END': 3,    # Pair 3' complementarity
        'PRIMER_MAX_END_STABILITY': 9.0,   # Max 3' end stability (delta G)
    }
)

Load Sequence from FASTA

from Bio import SeqIO

record = SeqIO.read('gene.fasta', 'fasta')
sequence = str(record.seq)

result = primer3.design_primers(
    seq_args={'SEQUENCE_TEMPLATE': sequence, 'SEQUENCE_ID': record.id},
    global_args={'PRIMER_PRODUCT_SIZE_RANGE': [[100, 300]], 'PRIMER_OPT_TM': 60.0}
)

Calculate Tm Directly

# Calculate Tm for an existing primer
tm = primer3.calc_tm('ATGCGATCGATCGATCGATC')
print(f'Tm: {tm:.1f}C')

# With custom salt/DNA concentrations
tm = primer3.calc_tm('ATGCGATCGATCGATCGATC', mv_conc=50.0, dv_conc=1.5, dntp_conc=0.2, dna_conc=50.0)

Tm Calculation Defaults

Parameter	Default	Description
mv_conc	50.0 mM	Monovalent cations (Na+, K+)
dv_conc	0.0 mM	Divalent cations (Mg2+)
dntp_conc	0.0 mM	dNTP concentration
dna_conc	50.0 nM	DNA oligo concentration

Calculate Hairpin and Dimer Tm

# Hairpin Tm
hairpin = primer3.calc_hairpin('ATGCGATCGATCGATCGATC')
print(f'Hairpin Tm: {hairpin.tm:.1f}C, dG: {hairpin.dg:.1f}')

# Homodimer Tm
homodimer = primer3.calc_homodimer('ATGCGATCGATCGATCGATC')
print(f'Homodimer Tm: {homodimer.tm:.1f}C, dG: {homodimer.dg:.1f}')

# Heterodimer Tm (between two different primers)
heterodimer = primer3.calc_heterodimer('ATGCGATCGATCGATCGATC', 'GCTAGCTAGCTAGCTAGCTA')
print(f'Heterodimer Tm: {heterodimer.tm:.1f}C, dG: {heterodimer.dg:.1f}')

Format Results as DataFrame

import pandas as pd

def primers_to_dataframe(result):
    rows = []
    for i in range(result['PRIMER_PAIR_NUM_RETURNED']):
        rows.append({
            'pair': i,
            'left_seq': result[f'PRIMER_LEFT_{i}_SEQUENCE'],
            'right_seq': result[f'PRIMER_RIGHT_{i}_SEQUENCE'],
            'left_tm': result[f'PRIMER_LEFT_{i}_TM'],
            'right_tm': result[f'PRIMER_RIGHT_{i}_TM'],
            'left_gc': result[f'PRIMER_LEFT_{i}_GC_PERCENT'],
            'right_gc': result[f'PRIMER_RIGHT_{i}_GC_PERCENT'],
            'product_size': result[f'PRIMER_PAIR_{i}_PRODUCT_SIZE'],
            'penalty': result[f'PRIMER_PAIR_{i}_PENALTY'],
        })
    return pd.DataFrame(rows)

df = primers_to_dataframe(result)
print(df)

Common Global Arguments

Parameter	Description	Default
PRIMER_PRODUCT_SIZE_RANGE	Allowed product sizes	[[100,300]]
PRIMER_NUM_RETURN	Number of primer pairs	5
PRIMER_MIN/OPT/MAX_SIZE	Primer length	18/20/27
PRIMER_MIN/OPT/MAX_TM	Melting temperature	57/60/63
PRIMER_MIN/MAX_GC	GC content percent	20/80
PRIMER_MAX_POLY_X	Max poly-X run	5
PRIMER_MAX_SELF_ANY	Self complementarity	8
PRIMER_MAX_SELF_END	3' self complementarity	3

Related Skills

• qpcr-primers - Design primers with internal probes for qPCR
• primer-validation - Check primers for specificity and secondary structures
• sequence-io - Load template sequences
• database-access/local-blast - BLAST primers for specificity checking

<!-- AUTHOR_SIGNATURE: 9a7f3c2e-MD-BABU-MIA-2026-MSSM-SECURE -->