name: bio-sequence-slicing description: Slice, extract, and concatenate biological sequences using Biopython. Use when extracting subsequences, joining sequences, or manipulating sequence regions by position. tool_type: python primary_tool: Bio.Seq measurable_outcome: Execute skill workflow successfully with valid output within 15 minutes. allowed-tools:

• read_file
• run_shell_command

Sequence Slicing

Extract, slice, and concatenate sequences using Biopython's Seq objects.

Required Import

from Bio.Seq import Seq

Core Operations

Indexing (Single Position)

seq = Seq('ATGCGATCG')
seq[0]      # 'A' - first base (0-indexed)
seq[-1]     # 'G' - last base
seq[3]      # 'C' - fourth base

Slicing (Extract Region)

seq = Seq('ATGCGATCGATCG')
seq[0:3]     # Seq('ATG') - first 3 bases
seq[3:6]     # Seq('CGA') - positions 3-5
seq[:5]      # Seq('ATGCG') - first 5
seq[-5:]     # Seq('GATCG') - last 5
seq[::2]     # Seq('AGGTGTG') - every 2nd base
seq[::-1]    # Seq('GCTAGCTAGCGTA') - reversed

Note: Slicing returns a Seq object, not a string.

Concatenation

seq1 = Seq('ATGC')
seq2 = Seq('GGGG')
combined = seq1 + seq2  # Seq('ATGCGGGG')

Can also concatenate with strings:

seq = Seq('ATGC')
extended = seq + 'NNNN'  # Seq('ATGCNNNN')

Code Patterns

Extract CDS by Coordinates

genome = Seq('NNNNATGCGATCGATCGTAANNN')
cds_start, cds_end = 4, 21
cds = genome[cds_start:cds_end]

Extract with 1-Based Coordinates

Biology often uses 1-based coordinates. Convert to 0-based:

def extract_1based(seq, start, end):
    '''Extract using 1-based inclusive coordinates'''
    return seq[start - 1:end]

genome = Seq('ATGCGATCGATCG')
region = extract_1based(genome, 1, 3)  # Seq('ATG')

Split Sequence into Codons

def split_codons(seq):
    return [seq[i:i+3] for i in range(0, len(seq) - len(seq) % 3, 3)]

seq = Seq('ATGCGATCGATCG')
codons = split_codons(seq)  # [Seq('ATG'), Seq('CGA'), ...]

Split into Fixed-Length Chunks

def chunk_sequence(seq, size):
    return [seq[i:i+size] for i in range(0, len(seq), size)]

seq = Seq('ATGCGATCGATCGATCGATCG')
chunks = chunk_sequence(seq, 10)

Join Sequences with Linker

seqs = [Seq('ATGC'), Seq('GGGG'), Seq('TTTT')]
linker = Seq('NNN')
joined = linker.join(seqs)  # Seq('ATGCNNNGGGGNNTTTT')

Or manually:

linker = 'NNN'
joined = Seq(linker.join(str(s) for s in seqs))

Extract Multiple Regions

def extract_regions(seq, regions):
    '''Extract and concatenate multiple regions'''
    return sum((seq[start:end] for start, end in regions), Seq(''))

exon_coords = [(0, 50), (100, 150), (200, 250)]
mrna = extract_regions(genomic_seq, exon_coords)

Extract Flanking Regions

def get_flanking(seq, position, flank_size):
    '''Get sequence around a position'''
    start = max(0, position - flank_size)
    end = min(len(seq), position + flank_size + 1)
    return seq[start:end]

seq = Seq('ATGCGATCGATCGATCGATCG')
flanking = get_flanking(seq, 10, 5)  # 5 bp on each side of position 10

Tile Sequence into Overlapping Windows

def sliding_windows(seq, window_size, step=1):
    for i in range(0, len(seq) - window_size + 1, step):
        yield seq[i:i + window_size]

seq = Seq('ATGCGATCGATCG')
for window in sliding_windows(seq, 5, 2):
    print(window)

Extract Feature from SeqRecord

from Bio import SeqIO

for record in SeqIO.parse('sequence.gb', 'genbank'):
    for feature in record.features:
        if feature.type == 'CDS':
            cds_seq = feature.extract(record.seq)
            print(f'{feature.qualifiers.get("gene", ["?"])[0]}: {cds_seq[:30]}...')

Create New SeqRecord from Slice

from Bio.SeqRecord import SeqRecord

original = SeqRecord(Seq('ATGCGATCGATCGATCG'), id='full', description='Full sequence')
subset = SeqRecord(original.seq[5:15], id='subset', description=f'Positions 5-15 of {original.id}')

Coordinate Systems

seq[0:3]

seq[0:3]

Common Errors

IndexError

Decision Tree

Need to extract or combine sequences?
├── Single position?
│   └── Use indexing: seq[i]
├── Contiguous region?
│   └── Use slicing: seq[start:end]
├── Multiple non-contiguous regions?
│   └── Extract each, concatenate with +
├── Join sequences?
│   ├── No linker: seq1 + seq2
│   └── With linker: linker.join(seqs)
├── Split into parts?
│   └── List comprehension with slicing
└── From GenBank features?
    └── Use feature.extract(record.seq)

Related Skills

• seq-objects - Create Seq and SeqRecord objects
• sequence-io/read-sequences - Parse GenBank files with features to extract
• transcription-translation - Translate extracted CDS regions
• alignment-files - Extract sequences from BAM using samtools fasta/fastq