BioSkills bio-small-rna-seq-smrna-preprocessing
Preprocess small RNA sequencing data with adapter trimming and size selection optimized for miRNA, piRNA, and other small RNAs. Use when preparing small RNA-seq reads for downstream quantification or discovery analysis.
git clone https://github.com/GPTomics/bioSkills
T=$(mktemp -d) && git clone --depth=1 https://github.com/GPTomics/bioSkills "$T" && mkdir -p ~/.claude/skills && cp -r "$T/small-rna-seq/smrna-preprocessing" ~/.claude/skills/gptomics-bioskills-bio-small-rna-seq-smrna-preprocessing && rm -rf "$T"
small-rna-seq/smrna-preprocessing/SKILL.mdVersion Compatibility
Reference examples tested with: cutadapt 4.4+, fastp 0.23+, matplotlib 3.8+
Before using code patterns, verify installed versions match. If versions differ:
- Python:
thenpip show <package>
to check signatureshelp(module.function) - CLI:
then<tool> --version
to confirm flags<tool> --help
If code throws ImportError, AttributeError, or TypeError, introspect the installed package and adapt the example to match the actual API rather than retrying.
Small RNA Preprocessing
"Preprocess my small RNA-seq reads" → Remove 3' adapter sequences and size-select reads in the small RNA range (18-30 nt for miRNA, 24-32 nt for piRNA) before quantification or discovery.
- CLI:
cutadapt -a ADAPTER -m 18 -M 30 -o trimmed.fastq input.fastq
Adapter Trimming with Cutadapt
Goal: Remove 3' adapter sequences and size-select reads in the small RNA range.
Approach: Run cutadapt with the kit-specific adapter, minimum/maximum length filters, and discard reads without adapter.
Small RNA libraries have specific 3' adapters that must be removed:
# Standard Illumina TruSeq small RNA adapter cutadapt \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 \ -M 30 \ --discard-untrimmed \ -o trimmed.fastq.gz \ input.fastq.gz # -a: 3' adapter sequence # -m 18: Minimum length (miRNAs are 18-25 nt) # -M 30: Maximum length (exclude longer fragments) # --discard-untrimmed: Remove reads without adapter (likely not small RNA)
Common Small RNA Adapters
| Kit | 3' Adapter Sequence |
|---|---|
| Illumina TruSeq | TGGAATTCTCGGGTGCCAAGG |
| NEBNext | AGATCGGAAGAGCACACGTCT |
| QIAseq | AACTGTAGGCACCATCAAT |
| Lexogen | TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC |
Size Selection
# Filter by length after trimming cutadapt \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 -M 26 \ -o mirna_length.fastq.gz \ input.fastq.gz # miRNA: 18-26 nt (typically 21-23 nt) # piRNA: 26-32 nt # snoRNA: variable, typically longer
Quality Trimming
# Trim low-quality bases from 3' end before adapter removal cutadapt \ -q 20 \ -a TGGAATTCTCGGGTGCCAAGG \ -m 18 \ -o trimmed.fastq.gz \ input.fastq.gz
Using fastp for Small RNA
# fastp with small RNA settings fastp \ --in1 input.fastq.gz \ --out1 trimmed.fastq.gz \ --adapter_sequence TGGAATTCTCGGGTGCCAAGG \ --length_required 18 \ --length_limit 30 \ --html report.html # Note: fastp auto-detects adapters but specifying is more reliable
Collapse Identical Reads
For small RNAs, collapsing identical sequences reduces computation:
# Using seqkit seqkit rmdup -s trimmed.fastq.gz -o collapsed.fasta # Using fastx_toolkit (legacy) fastx_collapser -i trimmed.fastq -o collapsed.fasta
Python Preprocessing
import gzip from collections import Counter def collapse_reads(fastq_path): '''Collapse identical sequences and count occurrences''' counts = Counter() with gzip.open(fastq_path, 'rt') as f: while True: header = f.readline() if not header: break seq = f.readline().strip() f.readline() # + f.readline() # qual # Only keep reads in miRNA size range if 18 <= len(seq) <= 26: counts[seq] += 1 return counts # Write collapsed FASTA def write_collapsed_fasta(counts, output_path): with open(output_path, 'w') as f: for i, (seq, count) in enumerate(counts.most_common()): f.write(f'>seq_{i}_x{count}\n{seq}\n')
QC Metrics for Small RNA
Key metrics to check:
- Read length distribution (should peak at 21-23 nt for miRNA)
- Adapter content (high if library is good)
- Percentage of reads in target size range
import matplotlib.pyplot as plt from collections import Counter def plot_length_distribution(fastq_path): lengths = Counter() with gzip.open(fastq_path, 'rt') as f: for i, line in enumerate(f): if i % 4 == 1: # Sequence line lengths[len(line.strip())] += 1 plt.bar(lengths.keys(), lengths.values()) plt.xlabel('Read Length') plt.ylabel('Count') plt.title('Small RNA Length Distribution') plt.savefig('length_dist.png')
Related Skills
- mirdeep2-analysis - Novel miRNA discovery
- mirge3-analysis - Fast miRNA quantification
- read-qc/adapter-trimming - General adapter trimming