Claude-skill-registry bio-crispr-library-design

CRISPR library design for genetic screens. Covers sgRNA selection, library composition, control design, and oligo ordering. Use when designing custom sgRNA libraries for knockout, activation, or interference screens.

install
source · Clone the upstream repo
git clone https://github.com/majiayu000/claude-skill-registry
Claude Code · Install into ~/.claude/skills/
T=$(mktemp -d) && git clone --depth=1 https://github.com/majiayu000/claude-skill-registry "$T" && mkdir -p ~/.claude/skills && cp -r "$T/skills/data/library-design" ~/.claude/skills/majiayu000-claude-skill-registry-bio-crispr-library-design && rm -rf "$T"
manifest: skills/data/library-design/SKILL.md
source content

Library Design

sgRNA Selection Criteria

import pandas as pd
import numpy as np
from Bio import SeqIO
from Bio.Seq import Seq

def score_sgrna(sequence, pam='NGG'):
    '''Score sgRNA based on multiple criteria.'''
    scores = {}

    gc_content = (sequence.count('G') + sequence.count('C')) / len(sequence)
    scores['gc_content'] = 1 - abs(gc_content - 0.5) * 2

    if len(sequence) >= 4:
        has_poly_t = 'TTTT' in sequence
        scores['poly_t'] = 0 if has_poly_t else 1

    starts_with_g = sequence.startswith('G')
    scores['start_g'] = 1 if starts_with_g else 0.5

    scores['length'] = 1 if len(sequence) == 20 else 0.8

    overall = np.mean(list(scores.values()))
    return overall, scores

def design_sgrnas_for_gene(gene_sequence, n_guides=4, pam='NGG'):
    '''Design sgRNAs targeting a gene.'''
    candidates = []

    pam_pattern = pam.replace('N', '[ACGT]')
    import re

    for strand in ['+', '-']:
        seq = gene_sequence if strand == '+' else str(Seq(gene_sequence).reverse_complement())

        for match in re.finditer(f'([ACGT]{{20}})({pam_pattern})', seq):
            sgrna = match.group(1)
            position = match.start()

            if strand == '-':
                position = len(seq) - position - 23

            score, details = score_sgrna(sgrna)

            candidates.append({
                'sequence': sgrna,
                'pam': match.group(2),
                'strand': strand,
                'position': position,
                'score': score,
                'gc_content': (sgrna.count('G') + sgrna.count('C')) / 20,
                **details
            })

    candidates_df = pd.DataFrame(candidates)
    candidates_df = candidates_df.sort_values('score', ascending=False)

    return candidates_df.head(n_guides)

gene_seq = 'ATGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGGCGATCGATCGATCGATCGAATCGATCGATCGAGG'
guides = design_sgrnas_for_gene(gene_seq, n_guides=5)
print(guides[['sequence', 'position', 'strand', 'score', 'gc_content']])

Library Composition

def design_library(gene_list, guides_per_gene=4, include_controls=True):
    '''Design complete library for gene list.'''
    library = []

    for gene in gene_list:
        gene_data = get_gene_sequence(gene)

        guides = design_sgrnas_for_gene(gene_data['sequence'], n_guides=guides_per_gene)

        for idx, guide in guides.iterrows():
            library.append({
                'gene': gene,
                'gene_id': gene_data.get('ensembl_id', ''),
                'guide_number': idx + 1,
                'sequence': guide['sequence'],
                'pam': guide['pam'],
                'position': guide['position'],
                'strand': guide['strand'],
                'score': guide['score'],
                'type': 'targeting'
            })

    if include_controls:
        controls = design_control_guides()
        library.extend(controls)

    return pd.DataFrame(library)

def get_gene_sequence(gene_name):
    '''Fetch gene sequence (placeholder - use Ensembl API or local files).'''
    return {
        'sequence': 'ATGC' * 250,
        'ensembl_id': f'ENSG_{hash(gene_name) % 100000:05d}'
    }

genes = ['TP53', 'BRCA1', 'KRAS', 'MYC', 'CDK4']
library = design_library(genes, guides_per_gene=4)
print(f'Library size: {len(library)} guides')
print(f'Genes: {library["gene"].nunique()}')

Control Guide Design

def design_control_guides(n_nontargeting=100, n_essential=20, n_nonessential=20):
    '''Design control guides for library.'''
    controls = []

    for i in range(n_nontargeting):
        sequence = generate_nontargeting_sequence()
        controls.append({
            'gene': f'NonTargeting_{i+1}',
            'gene_id': '',
            'guide_number': 1,
            'sequence': sequence,
            'pam': 'NGG',
            'position': -1,
            'strand': '',
            'score': 0,
            'type': 'non-targeting'
        })

    essential_genes = ['RPS3', 'RPL11', 'EIF3A', 'POLR2A', 'CDK1']
    for gene in essential_genes[:n_essential]:
        controls.append({
            'gene': gene,
            'gene_id': '',
            'guide_number': 1,
            'sequence': get_validated_guide(gene),
            'pam': 'NGG',
            'position': 0,
            'strand': '+',
            'score': 1,
            'type': 'essential-control'
        })

    nonessential_genes = ['AAVS1', 'ROSA26']
    for gene in nonessential_genes[:n_nonessential]:
        controls.append({
            'gene': gene,
            'gene_id': '',
            'guide_number': 1,
            'sequence': get_validated_guide(gene),
            'pam': 'NGG',
            'position': 0,
            'strand': '+',
            'score': 1,
            'type': 'safe-harbor-control'
        })

    return controls

def generate_nontargeting_sequence(length=20):
    '''Generate random non-targeting sequence.'''
    while True:
        seq = ''.join(np.random.choice(['A', 'C', 'G', 'T'], length))
        gc = (seq.count('G') + seq.count('C')) / length
        if 0.4 <= gc <= 0.6 and 'TTTT' not in seq:
            return seq

def get_validated_guide(gene):
    '''Get validated guide sequence for control gene.'''
    validated = {
        'RPS3': 'GAGCTTCTTCAGCAGCATGG',
        'RPL11': 'GAAACAGGGCATCATCTACG',
        'EIF3A': 'GTGCAAGAGGATGATGACAA',
        'AAVS1': 'GGGGCCACTAGGGACAGGAT',
        'ROSA26': 'GAAGATGGGCGGGAGTCTTC'
    }
    return validated.get(gene, generate_nontargeting_sequence())

Off-Target Analysis

def check_offtargets(guide_sequence, genome_index, max_mismatches=3):
    '''Check for potential off-target sites.'''
    from subprocess import run
    import tempfile

    with tempfile.NamedTemporaryFile(mode='w', suffix='.fa', delete=False) as f:
        f.write(f'>guide\n{guide_sequence}\n')
        query_file = f.name

    result = run(
        ['bowtie', '-a', '-n', str(max_mismatches), '-l', '20', genome_index, '-f', query_file],
        capture_output=True, text=True
    )

    offtargets = []
    for line in result.stdout.strip().split('\n'):
        if line:
            fields = line.split('\t')
            offtargets.append({
                'chromosome': fields[2],
                'position': int(fields[3]),
                'strand': fields[1],
                'mismatches': int(fields[7]) if len(fields) > 7 else 0
            })

    return offtargets

def filter_by_offtargets(library_df, genome_index, max_offtargets=10):
    '''Filter library to remove guides with too many off-targets.'''
    filtered = []

    for _, guide in library_df.iterrows():
        offtargets = check_offtargets(guide['sequence'], genome_index)
        n_offtargets = len([ot for ot in offtargets if ot['mismatches'] <= 2])

        if n_offtargets <= max_offtargets:
            guide_dict = guide.to_dict()
            guide_dict['n_offtargets'] = n_offtargets
            filtered.append(guide_dict)

    return pd.DataFrame(filtered)

Oligo Design for Cloning

def design_oligos(library_df, vector='lentiGuide-Puro'):
    '''Design oligos for library cloning.'''
    vector_specs = {
        'lentiGuide-Puro': {
            'forward_prefix': 'CACCG',
            'forward_suffix': '',
            'reverse_prefix': 'AAAC',
            'reverse_suffix': 'C'
        },
        'pLKO': {
            'forward_prefix': 'CCGG',
            'forward_suffix': 'CTCGAG',
            'reverse_prefix': 'AATTCTCGAG',
            'reverse_suffix': ''
        }
    }

    spec = vector_specs.get(vector, vector_specs['lentiGuide-Puro'])

    oligos = []
    for _, guide in library_df.iterrows():
        seq = guide['sequence']

        forward = spec['forward_prefix'] + seq + spec['forward_suffix']
        reverse = spec['reverse_prefix'] + str(Seq(seq).reverse_complement()) + spec['reverse_suffix']

        oligos.append({
            'guide_id': f"{guide['gene']}_{guide['guide_number']}",
            'gene': guide['gene'],
            'guide_sequence': seq,
            'forward_oligo': forward,
            'reverse_oligo': reverse,
            'type': guide.get('type', 'targeting')
        })

    return pd.DataFrame(oligos)

oligos = design_oligos(library)
oligos.to_csv('library_oligos.csv', index=False)
print(f'Designed {len(oligos)} oligo pairs')

Pool Design for Synthesis

def design_array_oligos(library_df, array_format='12K'):
    '''Design array oligos for pooled synthesis.'''
    formats = {
        '12K': {'capacity': 12000, 'length': 200},
        '92K': {'capacity': 92000, 'length': 150},
        '244K': {'capacity': 244000, 'length': 60}
    }

    spec = formats[array_format]

    primer_5 = 'AGGCTTGGATTTCTATAACTTCGTATAGCATACATTATACGAAGTTAT'
    primer_3 = 'ATAACTTCGTATAATGTATGCTATACGAAGTTATCTTGGATTTCTAGA'
    scaffold = 'GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC'

    array_oligos = []
    for _, guide in library_df.iterrows():
        full_oligo = primer_5 + guide['sequence'] + scaffold + primer_3

        if len(full_oligo) > spec['length']:
            print(f"Warning: {guide['gene']} oligo too long for {array_format}")
            continue

        array_oligos.append({
            'id': f"{guide['gene']}_{guide['guide_number']}",
            'sequence': full_oligo,
            'length': len(full_oligo)
        })

    if len(array_oligos) > spec['capacity']:
        print(f"Warning: Library ({len(array_oligos)}) exceeds {array_format} capacity ({spec['capacity']})")

    return pd.DataFrame(array_oligos)

array_oligos = design_array_oligos(library, '92K')
array_oligos.to_csv('array_synthesis.csv', index=False)

Library QC

def qc_library(library_df):
    '''Quality control checks for library design.'''
    qc = {}

    qc['total_guides'] = len(library_df)
    qc['unique_genes'] = library_df[library_df['type'] == 'targeting']['gene'].nunique()
    qc['guides_per_gene'] = library_df[library_df['type'] == 'targeting'].groupby('gene').size().describe()

    gc_contents = library_df['sequence'].apply(lambda x: (x.count('G') + x.count('C')) / len(x))
    qc['gc_mean'] = gc_contents.mean()
    qc['gc_std'] = gc_contents.std()
    qc['gc_range'] = (gc_contents.min(), gc_contents.max())

    has_poly_t = library_df['sequence'].apply(lambda x: 'TTTT' in x)
    qc['poly_t_count'] = has_poly_t.sum()

    type_counts = library_df['type'].value_counts()
    qc['control_ratio'] = type_counts.get('non-targeting', 0) / len(library_df)

    return qc

qc = qc_library(library)
print('Library QC:')
for key, value in qc.items():
    print(f'  {key}: {value}')

Alternative PAM Systems

The examples above use SpCas9 with NGG PAM. Alternative systems expand targeting range:

SystemPAMUse Case
SpCas9NGGStandard, most validated
SpCas9-NGNGRelaxed PAM requirement
SpRYNRN/NYNNear-PAMless, broadest targeting
Cas12a (Cpf1)TTTVAT-rich regions, staggered cuts
SaCas9NNGRRTAAV delivery (smaller gene)

For alternative PAMs, modify the

design_sgrnas_for_gene()
function:

# Cas12a example (TTTV PAM, 23nt guide)
def design_cas12a_guides(gene_sequence, n_guides=4):
    pam_pattern = 'TTT[ACG]'  # TTTV
    guide_length = 23

    for match in re.finditer(f'({pam_pattern})([ACGT]{{{guide_length}}})', gene_sequence):
        pam = match.group(1)
        guide = match.group(2)
        # Cas12a cuts downstream of guide
        # ...

Related Skills

  • mageck-analysis - Analyze screen results
  • crispresso-editing - Validate editing efficiency
  • screen-qc - QC sequencing data
  • hit-calling - Identify screen hits